View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_70 (Length: 235)
Name: NF8926_low_70
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_70 |
 |  |
|
| [»] scaffold0933 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0933 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0933
Description:
Target: scaffold0933; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 965 - 1006
Alignment:
| Q |
18 |
agataagtttactgttctctcttttaactatattttattgat |
59 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
965 |
agataagtttattgttctctcttttacctatattttattgat |
1006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 31209987 - 31209946
Alignment:
| Q |
18 |
agataagtttactgttctctcttttaactatattttattgat |
59 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31209987 |
agataagtttattgttctctcttttatctatattttattgat |
31209946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 2609557 - 2609517
Alignment:
| Q |
18 |
agataagtttactgttctctcttttaactatattttattga |
58 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2609557 |
agataagtttattgttctctcttttacctatattttattga |
2609517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 151
Target Start/End: Complemental strand, 31206477 - 31206448
Alignment:
| Q |
122 |
gtagataattcttatgactaattctacaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31206477 |
gtagataattcttatgactaattctacaac |
31206448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 6671303 - 6671262
Alignment:
| Q |
18 |
agataagtttactgttctctcttttaactatattttattgat |
59 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6671303 |
agataagtttattgttctctcttttagctatattttattgat |
6671262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 6667629 - 6667590
Alignment:
| Q |
20 |
ataagtttactgttctctcttttaactatattttattgat |
59 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6667629 |
ataagtttattgttctctcttttagctatattttattgat |
6667590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University