View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8927_high_3 (Length: 419)
Name: NF8927_high_3
Description: NF8927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8927_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 15 - 407
Target Start/End: Original strand, 53208999 - 53209391
Alignment:
| Q |
15 |
attttgtacaatgcactcattatcataggttgctgacccaaatcttgaagaagaaagaaaatccattgaagttatctagttgtagaggctaaagctgatc |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53208999 |
attttggacaatgcactcattatcataggttgctgacccaaatcttgaagaagaaagaaaatccattgaagttatctagttgtagaggctaaagctgatc |
53209098 |
T |
 |
| Q |
115 |
tatactttgcctcagcagaagagagcaagacattgtttgatgtttcttgacctccacgaaactaacactcaataaagaaaacaatggcttgcagttgaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209099 |
tatactttgcctcagcagaagagagcaagacattgtttgatgtttcttgacctccacgaaactaacactcaataaagaaaacaatggcttgcagttgaac |
53209198 |
T |
 |
| Q |
215 |
gtccaatgtcaatacatccaactaaatatgcatcactaaaatcaaagataggtacaattcagaagagcaaaggaaagaaaagtcacatccttaaacaaac |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209199 |
gtccaatgtcaatacatccaactaaatatgcatcactaaaatcaaagataggtacaattcagaagagcaaaggaaagaaaagtcacatccttaaacaaac |
53209298 |
T |
 |
| Q |
315 |
atgggaatgcatgaattagcttggtttttgtctatcacgagttacgttcggcctagtcattgtaagatacttgatagtcatagatcacaggtt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
53209299 |
atgggaatgcatgaattagcttggtttttgtctatcacgagttacgctcggcctagtcattgtaaggtacttgatagtcatagattacaggtt |
53209391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University