View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8927_high_6 (Length: 241)
Name: NF8927_high_6
Description: NF8927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8927_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2330137 - 2330365
Alignment:
| Q |
1 |
taatttcccctttgaagaactgtagttaactacaaattgttctctttggacgtgtttacgggcattagcaacatgggcaatatttactgaaaagcattat |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2330137 |
taatttcccatttgaagaactgtagttaattacaaattgttctctttggacgtgtttacgggcattagcaacatgggcaatatttactgaaaagcattat |
2330236 |
T |
 |
| Q |
101 |
atatatgcagaattttctagtgaactagtaatcgtgggatggggttaatcttcttgtttctcagtaatga-------ctgcagtagtaatagatgaaaaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2330237 |
atatatgcagaattttctagtgaactagtaatcgtgggatggggttaatcttcttgcttctcagtaatgactgcagtctgcagtagtaatagatgaaaaa |
2330336 |
T |
 |
| Q |
194 |
cttggttgttgttcctcttcattcttaag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2330337 |
cttggttgttgttcctcttcattcttaag |
2330365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 47776063 - 47776280
Alignment:
| Q |
1 |
taatttcccctttgaagaactgtagttaactacaaattgttctctttggacgtgtttacgggcattagcaacatgggcaatatttactgaaaagcattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47776063 |
taatttcccctttgaagaactgtagtta----caacttgttctctttggacgtgtttacgggcattagcaacatgggcaagatttactgaaaagcattat |
47776158 |
T |
 |
| Q |
101 |
atatatgcagaattttctagtgaactagtaatcgtgggatggggttaatcttcttgtttctcagtaatgactgcagtagtaatagatgaaaaacttggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47776159 |
atatatgcagaattttctagtgaactagtaattgtgggatggggttaatcttcttgcttcccagtaatcactgcagtagtaatagatgaaaaacttggtt |
47776258 |
T |
 |
| Q |
201 |
gttgttcctcttcattcttaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47776259 |
gttgttcctcttcattcttaag |
47776280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University