View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8928_low_33 (Length: 257)
Name: NF8928_low_33
Description: NF8928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8928_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 8445114 - 8445336
Alignment:
| Q |
16 |
taaaattgaagatatgcattgtagatggtctaaccgaccaaattccactgccatacaaatccaaagatctacttccataaccttctatctgtacttgaca |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445114 |
taaaattgaaggcatgcattgtagatggtctaaccgaccaaattccactgccatacaaatccaaagatctacttccataaccttctatctgtacttgaca |
8445213 |
T |
|
| Q |
116 |
cgtcccaaactcaattctatcatctctaataatactatcataaacataaacattactttcatatctaaatattattcattcattcttctcttatattaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8445214 |
cgtcccaaactcaattctatcatctctaataatactctcataaacataaacattactttcatatctaaatattattcattcattcttctct--tattaca |
8445311 |
T |
|
| Q |
216 |
caaaccaatctctttttatctctct |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8445312 |
caaaccaatctctttttatctctct |
8445336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University