View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8928_low_34 (Length: 241)
Name: NF8928_low_34
Description: NF8928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8928_low_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 154 - 241
Target Start/End: Original strand, 2513075 - 2513163
Alignment:
| Q |
154 |
ggtcggacaaaattaggtacaacaacttctagcaaaagatttcctt-nnnnnnnncttctaacaaaggtttcagtatcttttgtttttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2513075 |
ggtcggacaaaattaggtacaacaacttctagcaaaagatttccttaaaaaaaaacttctaacaaaggtttcagtatcttttgtttttt |
2513163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University