View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8928_low_35 (Length: 241)

Name: NF8928_low_35
Description: NF8928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8928_low_35
NF8928_low_35
[»] chr1 (1 HSPs)
chr1 (154-241)||(2513075-2513163)


Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 154 - 241
Target Start/End: Original strand, 2513075 - 2513163
Alignment:
154 ggtcggacaaaattaggtacaacaacttctagcaaaagatttcctt-nnnnnnnncttctaacaaaggtttcagtatcttttgtttttt 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||    
2513075 ggtcggacaaaattaggtacaacaacttctagcaaaagatttccttaaaaaaaaacttctaacaaaggtttcagtatcttttgtttttt 2513163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University