View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8929_low_12 (Length: 481)
Name: NF8929_low_12
Description: NF8929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8929_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 273 - 465
Target Start/End: Original strand, 39229390 - 39229582
Alignment:
| Q |
273 |
ataggttgatttggatttgggaaattatgagcgttttcttgatgttacacttacaaaggataataatattactactggcaaaatatatcaggtgcatgct |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39229390 |
ataggttgatttggatttgggaaattatgagcgttttcttgatgttacacttacaaaggataataatattactactggcaaaatatatcaggtgcatgct |
39229489 |
T |
 |
| Q |
373 |
tgtttcattttatgttatggatttcattaattaatactcaactttatgctaattttgctttatggtttcatgtgattatttttagtctgtgct |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39229490 |
tgtttcattttatgttatggatttcattaattaatactcaactttatgctaattttgctttatggtttcatgtgattatttttagtctgtgct |
39229582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 58 - 141
Target Start/End: Original strand, 39229176 - 39229259
Alignment:
| Q |
58 |
cagatccgtatttgaacattgacgctggtaccatgtctccgtttgaacatggagaggtttttgttcttgatgatggcggagagg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39229176 |
cagatccgtatttgaacattgacgctggtaccatgtctccgtttgaacatggagaggtttttgttcttgatgatggcggagagg |
39229259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University