View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8929_low_18 (Length: 418)
Name: NF8929_low_18
Description: NF8929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8929_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 19 - 402
Target Start/End: Complemental strand, 50419818 - 50419450
Alignment:
| Q |
19 |
tttaccaggtattaccttcatttccacttctttcnnnnnnnattcgtcgtagttggatttgattacttgattcggttattttcttcaattcagtgactgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50419818 |
tttaccaggtattaccttcatttccacttcttt--ttttttattcgtcgtagttggatttgattacttgattcggttatattcttcaattcagtgactgt |
50419721 |
T |
|
| Q |
119 |
ttgattcaactttcactttcagttttcactttgggttttattattaataagtaaaatcctaaactgattggattcgatcgatcgatctcatcttccgcca |
218 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419720 |
ttgattcaattttcactttcagtttt-------------attattaataagtaaaatcctaaactgattggattcgatcgatcgatctcatcttccgcca |
50419634 |
T |
|
| Q |
219 |
tggagatccgaaccgatgcagaatctacttcattttcttcaaggttttcttccttcaatcgcaagctagaatgtgtaattaatcaattaattaacagcta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419633 |
tggagatccgaaccgatgcagaatctacttcattttcttcaaggttttcttccttcaatcgcaagctagaatgtgtaattaatcaattaattaacagcta |
50419534 |
T |
|
| Q |
319 |
atctaattggtaaatgttgatgcagtttaatcgcggcagtgtcatatggaattgcttcaatggcaatggtttttatcaataaag |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419533 |
atctaattggtaaatgttgatgcagtttaatcgcggcagtgtcatatggaattgcttcaatggcaatggtttttatcaataaag |
50419450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University