View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8929_low_29 (Length: 324)
Name: NF8929_low_29
Description: NF8929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8929_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 323
Target Start/End: Complemental strand, 13713153 - 13712852
Alignment:
| Q |
17 |
cacctaaccctaaaatcttttcatctcagttgtatgtctgaactcactctgggagaatgagagtgactgtttctacagatgggttgaagctgcaaaacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
13713153 |
cacctaaccctaaaatcttttcatctcagttgtatgtttgaactc----tgggagaatgagagtgactatttcaacagatgggttgaagcggcaaaacac |
13713058 |
T |
|
| Q |
117 |
cgccacattgaggttctccgtctacactttccatattttttacacgtccctttggcacctaccatcttctgctgcaaaacccttgtgaatctgacattgt |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13713057 |
cgccacattgaggttctccgtctgcacttttcatattttttatacgtccctttggcgcctacaatcttctgctgcaaaacccttgtgaacctgacattga |
13712958 |
T |
|
| Q |
217 |
cgcatattcgtgttgccactatgtttcattgttctattaatcttcctttgctcaaaaccctttatctatcttcagttcaatctgaagatatgattagatt |
316 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
13712957 |
cgcttattcgtgttgccactatgtttcattgttctattaatcttcctttgctcaaaacccgttatctatcttcagttcaatttgaagatatga-aagatt |
13712859 |
T |
|
| Q |
317 |
tcatgaa |
323 |
Q |
| |
|
||||||| |
|
|
| T |
13712858 |
tcatgaa |
13712852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 19805621 - 19805667
Alignment:
| Q |
157 |
tacacgtccctttggcacctaccatcttctgctgcaaaacccttgtg |
203 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
19805621 |
tacacgtccctttagcacctactgtcttctgctgcaaaacacttgtg |
19805667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University