View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8930_high_10 (Length: 227)
Name: NF8930_high_10
Description: NF8930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8930_high_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 18357688 - 18357460
Alignment:
| Q |
1 |
ctgctcaaaatcagatggttagactaaatggctttgcagtctatacnnnnnnn--atttagtgctcaaaatacttctaaaattaaattccttttcaacca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18357688 |
ctgctcaaaatcagatggttagactaaatggctttgcagtctatactttttttttatttagtgctcaaaatacttctaaaattaaattccttttcaacca |
18357589 |
T |
 |
| Q |
99 |
atctacatttgtcactacctctaaaactttcaaatgttatgttgtggtggtactttgggaatatcagcatgttcagaactttggagtccctttcttcttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18357588 |
atctacatttgtcactacctctaaaactttcaaatgttatgttctggtggtactttgggaatatcagcatgttcagaactttggagaccctttcttcttg |
18357489 |
T |
 |
| Q |
199 |
gttatccgtgagggtgagactttagctga |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18357488 |
gttatccgtgagggtgagactttagctga |
18357460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University