View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8930_high_5 (Length: 349)
Name: NF8930_high_5
Description: NF8930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8930_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 35 - 339
Target Start/End: Complemental strand, 29381222 - 29380918
Alignment:
| Q |
35 |
ttaaataatacacgcgtcatttcttcaacagcgtagcactgcattgagccattatctttgatgccctggtaatggcatcagtcatgtagaaattctcaac |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29381222 |
ttaaataatacacgcatcatttcttcaacagcgtagcactgcattgagccattatctttgatgccctggtaatggcatcagtcatgtagaaattctcaac |
29381123 |
T |
|
| Q |
135 |
tgcaatcccgaatggtgttggatccaccttcttagtgaaggttggtctcagtgaagatggcaatgcagctggttctctctcgtccatttgcgcaaggttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29381122 |
tgcaatcccgaatggtgttggatccaccttcttagtgaaggttggtctcagtgaagatggcaatgcagctggttctctctcgtccatttgcgcaaggttt |
29381023 |
T |
|
| Q |
235 |
ggggctacagttctcaatcgggcgcgaacacccccaattgtatcatagggtaaacgcacccctgctatctcggacagagctcgaattatcttccagtcat |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29381022 |
ggggctacagttctcaatcgggcgcgaacacccccaattgtatcatagggtaaacgcacccctgctatctcggacagagctcgaattatcttccagtcat |
29380923 |
T |
|
| Q |
335 |
ctctg |
339 |
Q |
| |
|
||||| |
|
|
| T |
29380922 |
ctctg |
29380918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University