View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8930_high_6 (Length: 304)
Name: NF8930_high_6
Description: NF8930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8930_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 51 - 168
Target Start/End: Original strand, 18937744 - 18937861
Alignment:
| Q |
51 |
tttggaccttactactaatgcaaatgagaacatgggttcaagagaatgctgatgcagacataagtaagagccctccaaaactggggcatatataacacaa |
150 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18937744 |
tttggaacttactactaatgcaaatgagaacatgggttcaagagaatgctgatgcagacataagtaagagccctccaaaactggggcatatataacacaa |
18937843 |
T |
 |
| Q |
151 |
gttttatatggcatagta |
168 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
18937844 |
gttttatatggcatagta |
18937861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 167 - 288
Target Start/End: Original strand, 18938101 - 18938221
Alignment:
| Q |
167 |
taagtgttcctggaaatttacatcacacggggagtataatttaaagacaacgtatcactacatcatggaaattttattggataatagtgatttatgagtt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18938101 |
taagtgttcctggaaatttacatcacacggggagtataatgtaaagacaacgtatcactacatcatggaaatttta-tggataatagtgatttacgagtt |
18938199 |
T |
 |
| Q |
267 |
cccgataactggatgaaaatat |
288 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
18938200 |
cctgataactggatgaaaatat |
18938221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University