View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8930_low_14 (Length: 391)
Name: NF8930_low_14
Description: NF8930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8930_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 20 - 169
Target Start/End: Original strand, 37546525 - 37546674
Alignment:
| Q |
20 |
agtggcacttaaatgtcgtaggtgagtgacagtagactatgaatgtagtcagttcagggtgtctcaaagtagactatgaatgtctaaagatcaattttcg |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546525 |
agtggcagttaaatgtcgtaggtgagtgacagtagactatgaatgtagtcagttcagggtgtctgaaagtagactatgaatgtctaaagatcaattttcg |
37546624 |
T |
 |
| Q |
120 |
ttcagtattttctcatgaattactctaggagtccattaagctcactctaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
37546625 |
ttcagtattttctcatgaattactctaggagtccattaaactcacactaa |
37546674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 254 - 383
Target Start/End: Original strand, 37546753 - 37546882
Alignment:
| Q |
254 |
gtaacatatgtatttaaggtgccaaagatgaaaaatactatgtattggagtaattactatttataaaatccttgtgttctaaataaaaacatgtgattac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546753 |
gtaacatatgtatttaaggtgccaaagatgaaaaatactatgtattggagtaattactatttataaaatccttgtgttctaaataaaaacatgtgattac |
37546852 |
T |
 |
| Q |
354 |
caagaaaagatttggtctggtgagtattat |
383 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |
|
|
| T |
37546853 |
caagaaaatatttgatctggtgagtattat |
37546882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 37546705 - 37546742
Alignment:
| Q |
167 |
taatgcctccgttgctaatgcttttattgtattcttgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546705 |
taatgcctccgttgctaatgcttttattgtattcttgg |
37546742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University