View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8930_low_27 (Length: 238)

Name: NF8930_low_27
Description: NF8930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8930_low_27
NF8930_low_27
[»] chr5 (1 HSPs)
chr5 (1-170)||(26430855-26431024)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 26431024 - 26430855
Alignment:
1 ttaacgaaaacgcgaagcttaaggtgaagcagaaggaagatgagaaattatggaaaggacttgaatctaagttctcgtcaactaagactttgtgtgatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26431024 ttaacgaaaacgcgaagcttaaggtgaagcagaaggaagatgagaaattatggaaaggacttgaatctaagttctcgtcgactaagactttgtgtgatca 26430925  T
101 acttactgagactcttcaacaattggctggtatcgttcaagatggtaagtatgaagattcactcactagg 170  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26430924 acttactgagactcttcaacagttggctggtatcgttcaagatggtaagtatgaagattcactcactagg 26430855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University