View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_26 (Length: 351)
Name: NF8931_low_26
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 21582837 - 21582501
Alignment:
| Q |
1 |
tagaaggagggacaactttttcaaatcaaacaaatgttcatagcaaaggtcgtgctgctgccccaagtgtttcaaacaagaagggtgggggtt-cttgcg |
99 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
21582837 |
tagaaggagggacaactttttcaattccaacaaaagttaatagcaaaggtcgtgttgctgccccaagagtttcaaacaagaagggtgggggttacttgcg |
21582738 |
T |
|
| Q |
100 |
tcactgtgctcgtcggttgaagcatattgcgcgtctccctgacattgataaaaaggtagtgcttcgcgctttacgtaagactactaagaagaggaagaag |
199 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21582737 |
tcactgtgcccgtcggttgaaacatattgcgcgtctccctgacgctgatagaaaggaagtgcttcgcgctttacgtaagactactaagaagaggaagaag |
21582638 |
T |
|
| Q |
200 |
gtggctggtggctctcaagggattgtttctttctctgataaatctcctcaaagtggatcccaagcgtctgtaaataataatgactggtctaataggttgg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
21582637 |
gtggctggtggctctcaagggattgtttctttctctgataaatctcctcaaagtggatcccaagcatctgtaaataataatgactggtctaattggttgg |
21582538 |
T |
|
| Q |
300 |
ttgttcatggcaatgataagataaaggcagatgatgt |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21582537 |
ttgttcatggcaatgataaggtaaaggcagatgatgt |
21582501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University