View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_30 (Length: 319)
Name: NF8931_low_30
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 17797729 - 17798033
Alignment:
| Q |
1 |
ttgtcaagtcattttcatctctctcttcttttaaaccaatttctatcttttatcatcttgccttgcagtgtcagtaaaaagtgatgcgcactgagaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17797729 |
ttgtcaagtcattttcatctctctcttcttttaaaccaatttctatcttttatcatcttgccttgcagtgtcagtaaaaagtgatgcgcactgagaacat |
17797828 |
T |
 |
| Q |
101 |
tgtttgtgttgtgatgaatataatgagagtactaaatatttaaattcatctatgtcagtttctcagcnnnnnnnnctgttacaataatatatgccacaaa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
17797829 |
tgtttgtgttgtgatg-----aatgagagtactaaatatttaaattcatctatgtcagtttctcagcttttttttctgttac---aatatatgccacaaa |
17797920 |
T |
 |
| Q |
201 |
cacaagttgtggacacaacccccttaaaagtagactctctctcagaatcaatgtgaaaagattgt---------ttccttctcactcctgctaccttatt |
291 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
17797921 |
cacaagtagtggacacaacccccttaaaagtagactctctctcagaatgaatgtgaaaagattgttacactcacttccttctcactcctgctacattatt |
17798020 |
T |
 |
| Q |
292 |
tatcatcttcctg |
304 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17798021 |
tatcatcttcctg |
17798033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University