View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_31 (Length: 314)
Name: NF8931_low_31
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 312
Target Start/End: Complemental strand, 32834304 - 32834008
Alignment:
| Q |
16 |
cagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggctaaaggagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834304 |
cagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagacttgcctgatgagagaaaccctggaagtcgatgagttctggctaaaggagc |
32834205 |
T |
|
| Q |
116 |
atccgatttaggatgatgaattggtgtgtcttggagatcactacatttccttgaaggtatggcaatgggctctgatccagtagcagaaggtggtttttgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834204 |
atccgatttaggatgatgaattggtgtgtcttggagatcactacatttccttgaaggtatggcaatgggctctgatccagtagcagaaggtggtttttgt |
32834105 |
T |
|
| Q |
216 |
tccggtgccgatggtgacttttcttgtgtggaagattcttttccccgtgtagaggctccttcttctgctgtagaggcatcttttcccgtttcagaga |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834104 |
tccggtgctgatggtgacttttcttgtgtggaagattcttttcccggtgtagaggctccttcttctgctgtagaggcatcttttcccgtttcagaga |
32834008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 312
Target Start/End: Complemental strand, 32840718 - 32840422
Alignment:
| Q |
16 |
cagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggctaaaggagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32840718 |
cagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggctaaaggagc |
32840619 |
T |
|
| Q |
116 |
atccgatttaggatgatgaattggtgtgtcttggagatcactacatttccttgaaggtatggcaatgggctctgatccagtagcagaaggtggtttttgt |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32840618 |
atctgatttaggatgatgaattggtgtgtcttggagatcactacatttccttgaaggtatggcaatgggctctgattcagtagcagaaggtggtttttgt |
32840519 |
T |
|
| Q |
216 |
tccggtgccgatggtgacttttcttgtgtggaagattcttttccccgtgtagaggctccttcttctgctgtagaggcatcttttcccgtttcagaga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32840518 |
tccggtgccgatggtgacttttcttgtgtggaagattcttttcccggtgtagaggcaccttcttctgctgtagaggcatcttttcccgtttcagaga |
32840422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 69 - 193
Target Start/End: Original strand, 31682639 - 31682760
Alignment:
| Q |
69 |
cctgatgagagaaaccctggaagtcgatgagttctggctaaaggagcatccgatttaggatgatgaattggtgtgtcttggagatcactacatttccttg |
168 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
31682639 |
cctgatgagagaaacgatggaagttgatgagttccggctaaaggagcatccgattgaggatgataaattggtgtgtcttggag---actaggtttccttg |
31682735 |
T |
|
| Q |
169 |
aaggtatggcaatgggctctgatcc |
193 |
Q |
| |
|
|||||||| ||||| ||| |||||| |
|
|
| T |
31682736 |
aaggtatgacaatgagctttgatcc |
31682760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University