View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_32 (Length: 311)
Name: NF8931_low_32
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 2 - 292
Target Start/End: Complemental strand, 19592864 - 19592583
Alignment:
| Q |
2 |
ccaatccaatgcaccattttcaacgcaacgaccacaaccaccatatcaatttattgcaccatcatattcgtcgcagcagccaccacgaccaccatatcaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19592864 |
ccaatccaatgcaccattttcaacgcagcgaccacaaccaccatatcaatttattgcaccatcatattcgtcgcagcagccaccacgaccaccatatcat |
19592765 |
T |
|
| Q |
102 |
tttagtcgaccatcattttcgtcgcaaccaccacaacaagcacactattcttttcaacgatcttcttcatcgcagccagcacgaccaccatattattcta |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19592764 |
tttagtcgaccatcatttttgtcgcaaccaccaca---------ctattcttttcaacgatcttcttcatcgcagccagcacgaccaccatattattcta |
19592674 |
T |
|
| Q |
202 |
ttacaccatattcgtcggaaccaccacgatcatcccattctaatatggaacaaagtttcatcccaccacgatatcgctcttcaatgtggat |
292 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19592673 |
ttacaccatattcgtcggaaacaccacgatcatcccattctaatatggaacaaagtttcatcccaccacgatatcgctcttcaacgtggat |
19592583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University