View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_50 (Length: 258)
Name: NF8931_low_50
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_50 |
 |  |
|
| [»] scaffold0062 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0062 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 16193 - 15947
Alignment:
| Q |
12 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagcattagattggttgtagaactggtagttaacc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16193 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagctttagattggttgtagaactggtagttaacc |
16094 |
T |
 |
| Q |
112 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16093 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
15994 |
T |
 |
| Q |
212 |
cattcttaagttgggttataacttcccctatgcacctggcaaaacga |
258 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15993 |
cattcttaagttgagttataacttcccctatgcacctggcaaaacga |
15947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 26361 - 26115
Alignment:
| Q |
12 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagcattagattggttgtagaactggtagttaacc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26361 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagctttagattggttgtagaactggtagttaacc |
26262 |
T |
 |
| Q |
112 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26261 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
26162 |
T |
 |
| Q |
212 |
cattcttaagttgggttataacttcccctatgcacctggcaaaacga |
258 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26161 |
cattcttaagttgagttataacttcccctatgcacctggcaaaacga |
26115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #3
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 36527 - 36281
Alignment:
| Q |
12 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagcattagattggttgtagaactggtagttaacc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36527 |
tatactaggtttgtagtttcttgatacctggtcatagagttttagaaagtcgtcaagtgtggatacagctttagattggttgtagaactggtagttaacc |
36428 |
T |
 |
| Q |
112 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36427 |
caatttatattggcctcattttgccaaaacaagttgcggtagtggatttcattggtctcggatggagcaatggacacgatcttgatgcgtagataattat |
36328 |
T |
 |
| Q |
212 |
cattcttaagttgggttataacttcccctatgcacctggcaaaacga |
258 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36327 |
cattcttaagttgagttataacttcccctatgcacctggcaaaacga |
36281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University