View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_63 (Length: 242)
Name: NF8931_low_63
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 46 - 231
Target Start/End: Original strand, 13097105 - 13097290
Alignment:
| Q |
46 |
accccatcttatcagaagtttcattctttagagtaaggattccaatctaagatttgtgtcaaaaagtaaaccctaactattgttgtgtgtgcttgagtcc |
145 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13097105 |
accctatcttatcagaagtttcattcttttgagtaaggattccaatctaaaatttgtgtcaaaaagtaaaccctaactattgttgtgcgtgcttgagtcc |
13097204 |
T |
|
| Q |
146 |
aacaagaacgatacttataaatcataagaatgataacaagtggaaaatatgagatgtggcatttctagtttgtcggtggtcgaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13097205 |
aacaagaacgatacttataaatcataagaatgataacaagtggaagatatgagatgtggcatttctagtttgtcggtggtcgaggg |
13097290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 46 - 231
Target Start/End: Original strand, 13026921 - 13027106
Alignment:
| Q |
46 |
accccatcttatcagaagtttcattctttagagtaaggattccaatctaagatttgtgtcaaaaagtaaaccctaactattgttgtgtgtgcttgagtcc |
145 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13026921 |
accctatcttatcagaagtttcattcttttgagtaaggattccaatctaaaatttgtgtcaaaaagtaaaccctaactattgttgtgcgtgcttgagtcc |
13027020 |
T |
|
| Q |
146 |
aacaagaacgatacttataaatcataagaatgataacaagtggaaaatatgagatgtggcatttctagtttgtcggtggtcgaggg |
231 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13027021 |
aacaaaaatgatacttataaatcataagaatgataacaagtggaagatatgagatgtggcatttctagtttgtcggtggtcgaggg |
13027106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University