View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_65 (Length: 237)
Name: NF8931_low_65
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 6752827 - 6752627
Alignment:
| Q |
1 |
tgtagtgcacctcagtctacgtcgtttccatagccatggagttaacatttgcactagccttggaaccatcattatttatgtggacaccacttgtattatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6752827 |
tgtagtgcacctcagtctacgtcgtttccatagccatggagttgacatttgcactagccttggaaccatccttatttatgtggacaccacttgtattatt |
6752728 |
T |
 |
| Q |
101 |
aatttcatgcttattacacatgttggatcctttgcttatttcttccgtagccattacatgtgtatcttgctccaatatttcataccttccttcttccaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6752727 |
aatttcatgcttattacacatgttggatcctttgcttatttcttccgtagccattacatgtgtatcttggtccaatatttcataccttccttcttccaca |
6752628 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
6752627 |
t |
6752627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 1811707 - 1811761
Alignment:
| Q |
1 |
tgtagtgcacctcagtctacgtcgtttccatagccatggagttaacatttgcact |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1811707 |
tgtagtgcacctcagtctacgtcgtttccatagccatggaattaacatttgcact |
1811761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University