View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_67 (Length: 232)
Name: NF8931_low_67
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 86 - 214
Target Start/End: Complemental strand, 30199432 - 30199304
Alignment:
| Q |
86 |
agattgagaaccgtacgagatgtggttaagggatggcgtctccggggtttccgattgacggtgggcagtatgctgacggcagcagttgagaacagagaag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30199432 |
agattgagaaccgtacgagatgtggttaagggatagcgtctccggggtttccgattgacggtgggcagtatgctgacggcagcagttgagaacagagaag |
30199333 |
T |
|
| Q |
186 |
cacaccgaagtgaagtgagactccgaact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30199332 |
cacaccgaagtgaagtgagactccgaact |
30199304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 30199504 - 30199464
Alignment:
| Q |
15 |
taaaacagagttcatggtacaatgagtatgagagaatgaag |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30199504 |
taaaacagagttcatggtacaatgagtatgagagaatgaag |
30199464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University