View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8931_low_68 (Length: 232)
Name: NF8931_low_68
Description: NF8931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8931_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 145
Target Start/End: Complemental strand, 53953670 - 53953547
Alignment:
| Q |
19 |
acccacttgggttgacttggtgatattggcttgatatcggggagtgtgctcaggttcaatcatgtcaattttggatgggctaatttagcttcttcttacc |
118 |
Q |
| |
|
|||||| ||| ||||||||||||||||| ||||||||| |||||| ||||||||| || ||||||||||| |||||| |||||||||||||||| ||| |
|
|
| T |
53953670 |
acccacctggattgacttggtgatattgacttgatatctaagagtgtcctcaggttcgattatgtcaatttt-gatgggttaatttagcttcttctaacc |
53953572 |
T |
|
| Q |
119 |
caataaggtggtgctggcactctaaat |
145 |
Q |
| |
|
| ||||||||||||| ||||||||||| |
|
|
| T |
53953571 |
c-ataaggtggtgct-gcactctaaat |
53953547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 53953493 - 53953452
Alignment:
| Q |
178 |
acaacctccgttgcctcttcgacccaaagcccaccaccacca |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
53953493 |
acaacctccattgcctcttcgacccaaagcccgccaccacca |
53953452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 37233647 - 37233597
Alignment:
| Q |
19 |
acccacttgggttgacttggtgatattggcttgatatcggggagtgtgctc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
37233647 |
acccacttgggttgacttggtgatattggcttgggatgtgggagtgtgctc |
37233597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 25590612 - 25590662
Alignment:
| Q |
19 |
acccacttgggttgacttggtgatattggcttgatatcggggagtgtgctc |
69 |
Q |
| |
|
|||||||||||||||| || || ||||||||||| ||| |||||||||||| |
|
|
| T |
25590612 |
acccacttgggttgacctgttggtattggcttgagatctgggagtgtgctc |
25590662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 48771939 - 48771989
Alignment:
| Q |
19 |
acccacttgggttgacttggtgatattggcttgatatcggggagtgtgctc |
69 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
48771939 |
acccacttgggttggcttggtggtattggcttgggatctgggagtgtgctc |
48771989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 28783061 - 28783111
Alignment:
| Q |
19 |
acccacttgggttgacttggtgatattggcttgatatcggggagtgtgctc |
69 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| | | |||||||||||| |
|
|
| T |
28783061 |
acccacttgggttggcttggtggtattggcttgagacctgggagtgtgctc |
28783111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University