View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8932_low_13 (Length: 419)
Name: NF8932_low_13
Description: NF8932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8932_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 24 - 342
Target Start/End: Complemental strand, 53017121 - 53016801
Alignment:
| Q |
24 |
ttgtatacatttgcttttattttgacaaatccgaaggcttgaattatgcagttttactatgtgttttcaaatttattagttaaaacacattcaaatacaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53017121 |
ttgtatacatttgcttttattttgacaaatccgaaggcttgaattatgcagttttactatgtgttttcaaatttattagttaaaacacattcaaatataa |
53017022 |
T |
|
| Q |
124 |
aaattcaacttaagagttaagtaaatgatcgatgactgtcatgtgttgtttcaaactt--nnnnnnnnnnnnnnccttgtcagtggcaaatcaaagtaca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53017021 |
aaattcaacttaagagttaagtaaatgatcgatgactgtcatgtgttgtttcaaacttaaaagagcaaaaaaaaccttgtcagtggcaaatcaaagtaca |
53016922 |
T |
|
| Q |
222 |
tgatatgtatgggactgattatgattatggttcgggtgagagaattttaattgttgtaaggattttaatacttcaaagggctcacttataaattgttttt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53016921 |
tgatatgtatgggactgattatgattatagttcgggtgagagaattttaattgttgtaaggattttaatacttcaaagggctcacttatatattgttttt |
53016822 |
T |
|
| Q |
322 |
gaagaatatgcttcgcctttt |
342 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53016821 |
gaagaatatgcttcgcctttt |
53016801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University