View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8932_low_14 (Length: 397)
Name: NF8932_low_14
Description: NF8932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8932_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 11 - 381
Target Start/End: Complemental strand, 52112145 - 52111775
Alignment:
| Q |
11 |
tttggtggtggaactgtttcttcgttatgatacttttggtattcaagttggaaaatctcctataggatctgctgttacctttacctctctcaagaaagct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112145 |
tttggtggtggaactgtttcttcgttatgatacttttggtattcaagttggaaaatctcctataggatctgctgttacctttacctctctcaagaaagct |
52112046 |
T |
 |
| Q |
111 |
aaattttagttttgtagttttgttttacttcataatacattttctggattaattattaattgtttaattgcatgtatatgcatgatgcatcccgcagctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112045 |
aaattttagttttgtagttttgttttacttcataatacattttctggattaattattaattgtttaattgcatgtatatgcatgatgcatcccgcagctt |
52111946 |
T |
 |
| Q |
211 |
atggttcatccacatatatattggcccagattaagataatttaagtttttgtttgtttgtttatgatgactacttgtacgtattacgagaggaatgtgac |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52111945 |
atggttcatccacatatatattggcccagattaagataatttaagtttttgtttgtttgtttatgatgactacttgtacgtattacgagaggaatgtgac |
52111846 |
T |
 |
| Q |
311 |
caacttcacctatgaagttaannnnnnnagaatttatttaattaatttaatcaccaccaatatgtttgatt |
381 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52111845 |
caacttcacctatgaagttaatttttttagaatttatttaattaatttaatcaccaccaatatgtttgatt |
52111775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University