View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8933_low_12 (Length: 262)
Name: NF8933_low_12
Description: NF8933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8933_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 43132340 - 43132572
Alignment:
| Q |
19 |
gttatgtctacaatatattggatttgcaggtaattttttgcttagtaacatgatcatcaattcaagttagtatctatcgcgtttatagtaacatcgatat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43132340 |
gttatgtctacaatatattggatttgcaggtaattttttgcttagtaacatgatcatcaattcaagttagtatctatcgcgtttatagtaacatccatat |
43132439 |
T |
 |
| Q |
119 |
tatactgttttaggaatgtgtttgcttatgcttgacggagaatatgtactcggttctaaatcatcttgtccaatatagtctagcgttcaaatcctgagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132440 |
tatactgttttaggaatgtgtttgcttatgcttgacggagaatatgtactcggttctaaatcatcttgtccaatatagtctagcgttcaaatcctgagaa |
43132539 |
T |
 |
| Q |
219 |
attaacgtacccactaacttagtattatctacc |
251 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||| |
|
|
| T |
43132540 |
attaacgtatccactaacttagtaatatttacc |
43132572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University