View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8934_low_20 (Length: 281)
Name: NF8934_low_20
Description: NF8934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8934_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 22402793 - 22402633
Alignment:
| Q |
1 |
cctataaccaaaataatgtgttcctaaaaatttggatcttatgcccacgtctttggcaactagaaggaatataacatgagggagaactagaattttagaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22402793 |
cctataaccaaaataatatgttcctaaacatttggaacttatgcccacgtctttggcaactagaaggaatataacatgagggagaactagaattttagaa |
22402694 |
T |
 |
| Q |
101 |
cagataagaataagtctctcacgtgtgtttacaacctaccaaggaatggttcaactttgac |
161 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22402693 |
ctgataagaataagtctctcaagtgtgtttacaacctaccaaggaatggttcaactttgac |
22402633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University