View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8934_low_32 (Length: 207)

Name: NF8934_low_32
Description: NF8934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8934_low_32
NF8934_low_32
[»] chr4 (1 HSPs)
chr4 (20-185)||(49756609-49756774)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 49756609 - 49756774
Alignment:
20 agaggagctggcattgaggtttgttggtttcacattatgatgatttcatatatgcatgcagtaatgtttgtggatggagatgaatttatttattaaaaga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49756609 agaggagctggcattgaggtttgttggtttcacattatgatgatttcatatatgcatgcagtaatgtttgtggatggagatgaatttatttattaaaaga 49756708  T
120 gtttgaacttaataattgttaggtgaggattgccagaatctttaacacatacggaccaagaatgtg 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49756709 gtttgaacttaataattgttaggtgaggattgccagaatctttaacacatacggaccaagaatgtg 49756774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University