View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8935_high_5 (Length: 307)
Name: NF8935_high_5
Description: NF8935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8935_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 8 - 290
Target Start/End: Complemental strand, 5352400 - 5352118
Alignment:
| Q |
8 |
gcagaacctgtgaggtttatacccgaggctgtttctgttattattcaagttaaagtctcatttgataggcttaacacttttctgtttgatgatgagataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5352400 |
gcagaacctgtgaggtttatacccgaagctgtttctgttattattcaagttaaagtctcatttgataggcttaacatttttctgtttgatgatgagataa |
5352301 |
T |
 |
| Q |
108 |
atacttcctaccaaaagaagagcatttatgtttcaaaatcaggtaaatgcattgagatagaggaagctgatttcagctgggatgagggatcagttacacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5352300 |
atacttcctaccaaaagaagagcatttatgtttcaaaatcaggtaaatgcattgagatagaggaagctgatttcagttgggatgagggatcagttacacc |
5352201 |
T |
 |
| Q |
208 |
tactttgagacaaattaatttcggcatcaaacatggtgaaaaagttgcagtttgtggaccagttggggctggcaagtcttctt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352200 |
tactttgagacaaattaatttcggcatcaaacatggtgaaaaagttgcagtttgtggaccagttggggctggcaagtcttctt |
5352118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University