View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8935_low_15 (Length: 310)
Name: NF8935_low_15
Description: NF8935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8935_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 42668155 - 42668432
Alignment:
| Q |
16 |
atatgtgcccactagatactttttaacttcataatagaatcaaattatgacttatgtattattgtatcatcacacccttcacccgttttagctgtagttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42668155 |
atatgtgcccactagatactttttaacttcataatagaatcaaattgtgacttatgtattattgtatcatcacacccttcacccgttttagctgtagttc |
42668254 |
T |
 |
| Q |
116 |
cagttatttcaattcaaggcaacatgtttataaatgcaaatatataaatcttattataaatttatgccgacattaatggtgtaatttatttctcataatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42668255 |
cagttatttcaattcaaggcaacatgtttataaatgcaaatatataaatcttattataaatttatgccgacattaatggtgtaatttatttctcataatc |
42668354 |
T |
 |
| Q |
216 |
taagcttttatagtgacaaaaagttgctgacatatgaagctaaatctagtcttgcaacatctttgaaaacgaagacac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42668355 |
taagcttttatagtgacaaaaagttgctgacatatgaagctaaatctagtcttgcaacatctttgaaaacgaagacac |
42668432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University