View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8935_low_22 (Length: 247)
Name: NF8935_low_22
Description: NF8935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8935_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 29341434 - 29341218
Alignment:
| Q |
17 |
agaaaataattatttgcctgatttgtatgcgaaaacaaggtatcccatccctttctccaagtcatgattttcacaatatatgtgtaactaatgagttaga |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29341434 |
agaaaataattatt-gcctgatttgtatgcaaaaacatggtatcccatccctttctccaagtcatgattt-cacaatatatgtgtaactaatgagttaga |
29341337 |
T |
|
| Q |
117 |
tataagattagattccatgtcttgtggtcccaaagatataatccttgagaccttttccaattactcaaaacaaaagctgtattgatgagtccaatagatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29341336 |
tataagattagattccatgtcttgtggtcccaaagatataatccttgagaccttttccaattactcaaaacaaaagctgtattgatgagtccaatagatt |
29341237 |
T |
|
| Q |
217 |
ccagaattatgacacaggt |
235 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
29341236 |
ccagaattatgatacaggt |
29341218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University