View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8936_high_14 (Length: 252)
Name: NF8936_high_14
Description: NF8936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8936_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 6608034 - 6608272
Alignment:
| Q |
16 |
agacaaagttgcttgacgtaatttgcatggcatacgtgaatagcccaaacggacggatggtccttttcaatttcattttatcttcttccattgtcaacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6608034 |
agacaaagttgcttgacgtaatttgcatggcatacgtgaatagcccaaacggacggatggtccttttcaatttcattttatcttcttccattgtcaacaa |
6608133 |
T |
 |
| Q |
116 |
catctaacctaactcacgagaaaaatatcacagtacgtacttgttcagaaattttgaaccattgaactcttctctagaattgtacaga----------ag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6608134 |
catctaacctaactcacgagaaaaatatcacagtacgtacttgttcagaaattttgaaccattgaactcttctctagaattgtacagaagcggtgtgtag |
6608233 |
T |
 |
| Q |
206 |
cggtgtagaacctctactataaatacaggtccaagttcc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6608234 |
cggtgtagaacctctactataaatacaggtccaagttcc |
6608272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University