View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8936_low_27 (Length: 307)
Name: NF8936_low_27
Description: NF8936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8936_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 62 - 294
Target Start/End: Complemental strand, 38856146 - 38855910
Alignment:
| Q |
62 |
ataactaagtgggggcgttgggtttattgaattcacattatgaatgagtttgaggtttttt--ggtttggatggaatggaaagcactagcaatgtggaat |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38856146 |
ataactaagtgggggcgttgggtttattgaattcacattatga----gtttgaggttttttttggtttggatggaatggaaagcactagcaatgttgaat |
38856051 |
T |
 |
| Q |
160 |
gggctttgaataatagagataaattattgactttgacttgtaaactt------ggaagcagaagaatgaattgaatggtgatgaaagaggcgttgatttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38856050 |
gggctttgaataatagagataaattattgactttgacttgtaaacttggaattggaagcagaagaatgaattgaatggtgatgaaagaggcgttgatttt |
38855951 |
T |
 |
| Q |
254 |
tcaaacaagtcacatagatgcagggccaacatttttagtct |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38855950 |
tcaaacaagtcacattgatgcagggccaacatttttagtct |
38855910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University