View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8936_low_34 (Length: 241)
Name: NF8936_low_34
Description: NF8936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8936_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6608279 - 6608513
Alignment:
| Q |
1 |
ctcaaattcattttttgtgcactcgtttgnnnnnnntatttgtttcataacacaatggggaaccaactaatt---tgcaaaaggtatgatccatcaattt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6608279 |
ctcaaattcattttttgtgcactcgtttgaaaaaaatatttgtttcataacacaatggggaaccaactaattatttgcaaaaggtatgatccatcaattt |
6608378 |
T |
 |
| Q |
98 |
aacttaaatttctatgcttccattaatcaagactcatctatatatatgttccagttttat--------tgttttacatattaaaaaatttacagacgaaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6608379 |
aacttaaatttctatgcttccattaatcaagactcatctatatatatgttccagttttattgttttactgttttacatattaaaaaatttacagacgaaa |
6608478 |
T |
 |
| Q |
190 |
attaaggtcgaagaaaaggccaacgggttttgttc |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6608479 |
attaaggtcgaagaaaaggccaatgggttttgttc |
6608513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University