View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8937_high_16 (Length: 300)
Name: NF8937_high_16
Description: NF8937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8937_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 37224264 - 37224544
Alignment:
| Q |
1 |
agacaaggaccaagaaacagtttgaagtggaactgacattgatccacttgccattgtgaagaacttgaaggccactaactccattctggatgaggaggtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224264 |
agacgaggaccaagaaacagtttgaagtggaactgacattgatccacttgccattgtgaagaacttgaaggccactaactccattctggatgaggaggtt |
37224363 |
T |
 |
| Q |
101 |
caagaggccatgatcggaatgtgggggcattcccattgcaagctcaggttgaggacaaggaggataaagatttgctgccaacatttgtaaaccagaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224364 |
caagaggccatgatcggaatgtgggggcattcccattgcaagatcaggttgaggacaaggaggataaagatttgctgccaacatttgtaaaccagaatct |
37224463 |
T |
 |
| Q |
201 |
agattcattgttttgtctatatagttgacttccaaacccaaactttctgatattcctttgagaagttctctacctaatttc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224464 |
agattcattgttttgtctatatagttgacttccaaacccaaactttctgatattcctttgagaagttctctacctaatttc |
37224544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University