View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8938_low_17 (Length: 301)
Name: NF8938_low_17
Description: NF8938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8938_low_17 |
 |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 101 - 283
Target Start/End: Original strand, 10244576 - 10244754
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagccttaataaaatgagtaaattttgattttggtcttgtaaannnnnnnnnnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||| ||| || |||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10244576 |
attttgcaaaatagtgaaaacaggaagaccaaaactgcaattaagtcttaataaaatgagtaaattttgattttgg----gtaaaatttttgtttttttc |
10244671 |
T |
 |
| Q |
201 |
ccaccattttcaaatctaaaatcatcattattttgacttgnnnnnnnttatcattatttttcatcaataatattcatcttagg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10244672 |
ccaccattttcaaatctaaaatcatcattattttgacttgaaaaaaattatcattatttttcatcaataatattcattttagg |
10244754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 105
Target Start/End: Original strand, 10244218 - 10244314
Alignment:
| Q |
16 |
agagatgtaatggtcaagtaattatgaaataaatataggaataaatat-------gtgttaataaaaggcttaattgctgtcttgatcctctatttt |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||| ||||| |||||||||||||| |||||||| || |||||| ||||||| |
|
|
| T |
10244218 |
agagatgtaaaggtcaagtaattatgaaataaataaaggaatgaatatgttttcagtgttaataaaaggtttaattgcagttttgatctactatttt |
10244314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 28587656 - 28587610
Alignment:
| Q |
103 |
tttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcctt |
149 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
28587656 |
tttgcaaaatggtgaaaacagggggaccaaaactgcaattaagcctt |
28587610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 101 - 149
Target Start/End: Complemental strand, 43670739 - 43670691
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcctt |
149 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43670739 |
attttgcaaaagagtgaaaatagggggaccaaaactgcaattaagcctt |
43670691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 148
Target Start/End: Original strand, 44858102 - 44858149
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
44858102 |
attttgcaaaatggtaaaaatagggggatcaaaactgcaattaagcct |
44858149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 101 - 149
Target Start/End: Original strand, 3565657 - 3565705
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
3565657 |
attttgcaaaatagtgaaaataggagaaccaaaactgcaattaagcctt |
3565705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 37327335 - 37327296
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaa |
144 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37327335 |
tgcaaaatggtgaaaatagggggatcaaaactgcaattaa |
37327296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 101 - 147
Target Start/End: Complemental strand, 29366393 - 29366347
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcc |
147 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
29366393 |
attttgcaaaattgtgaaaatagggggaccaaaactacaattaagcc |
29366347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 25189688 - 25189734
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagccttaa |
151 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
25189688 |
tgcaaaatggtaaaaatagggggaccaaaactgcaattaagccttaa |
25189734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 145
Target Start/End: Complemental strand, 14741982 - 14741938
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaag |
145 |
Q |
| |
|
|||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
14741982 |
attttgcaaagtggtgaaaatagggggaccaaaactgcaattaag |
14741938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 105 - 149
Target Start/End: Original strand, 38216373 - 38216417
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagcctt |
149 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
38216373 |
tgcaaaatggtgaaaatagggggaccaaaactgcaattaaacctt |
38216417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 105 - 148
Target Start/End: Complemental strand, 39450658 - 39450615
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
39450658 |
tgcaaaatggtgaaaatagggggacaaaaactgcaattaagcct |
39450615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 105 - 146
Target Start/End: Original strand, 21424 - 21465
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagc |
146 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
21424 |
tgcaaaatggtgaaaatagggggatcaaaactgcaaataagc |
21465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 12499053 - 12499012
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagc |
146 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
12499053 |
tgcaaaatggtgaaaatagggggatcaaaactgcaaataagc |
12499012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 148
Target Start/End: Complemental strand, 44362948 - 44362907
Alignment:
| Q |
107 |
caaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44362948 |
caaaatggtgaaaatagggggaccaaaactgcaattaagcct |
44362907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 105 - 148
Target Start/End: Original strand, 18879379 - 18879422
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
18879379 |
tgcaaaatggtgaaaatagggggaccaaaattgcaattaagcct |
18879422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 101 - 148
Target Start/End: Original strand, 20771712 - 20771759
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
20771712 |
attttgcaaaatgatgaaaatagggggaccaaaactacaattaagcct |
20771759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 101 - 148
Target Start/End: Original strand, 20781506 - 20781553
Alignment:
| Q |
101 |
attttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcct |
148 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
20781506 |
attttgcaaaatgatgaaaatagggggaccaaaactacaattaagcct |
20781553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 105 - 146
Target Start/End: Original strand, 3207900 - 3207941
Alignment:
| Q |
105 |
tgcaaaatagtgaaaatagggggatcaaaactgcaattaagc |
146 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3207900 |
tgcaaaatagtgaaaatagggggacaaaaagtgcaattaagc |
3207941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 34922025 - 34921979
Alignment:
| Q |
103 |
tttgcaaaatagtgaaaatagggggatcaaaactgcaattaagcctt |
149 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
34922025 |
tttgcaaaatagtgaaaacatggggaccaaaactacaattaagcctt |
34921979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University