View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8938_low_27 (Length: 239)

Name: NF8938_low_27
Description: NF8938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8938_low_27
NF8938_low_27
[»] chr1 (2 HSPs)
chr1 (137-223)||(28745557-28745643)
chr1 (6-104)||(28745673-28745781)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 137 - 223
Target Start/End: Complemental strand, 28745643 - 28745557
Alignment:
137 acagcgaaacaaaaatgacaatctctcaaaacgacgacgacgattctttcacaaacgacgatcgacgcatgagtctcatcgactttt 223  Q
    |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
28745643 acagcgaaacgacaatgacaatctctcaaaacgacgacgacgattctttcacaaacgatgatcgacgcatgagtctcatcgactttt 28745557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 104
Target Start/End: Complemental strand, 28745781 - 28745673
Alignment:
6 ccaatccaaatacaccctactttacactgttttggcgcga--ctctcac----at---attatctca-tctcagtcagttacaaatattcaagcaatagc 95  Q
    |||||||||||||||||||||||||| | |||||||||||   | ||||    ||   ||||||||| ||||||||||||||||||||||||||||||||    
28745781 ccaatccaaatacaccctactttacaatattttggcgcgagggtttcaccctaattcaattatctcagtctcagtcagttacaaatattcaagcaatagc 28745682  T
96 gaaaccgca 104  Q
    |||||||||    
28745681 gaaaccgca 28745673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University