View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8939_low_31 (Length: 339)
Name: NF8939_low_31
Description: NF8939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8939_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 333
Target Start/End: Complemental strand, 6353669 - 6353356
Alignment:
| Q |
20 |
aaaagagcatcaaatcttttttcctaataaatctgcactggagttggtctctctgaaacaatgttgaatggtggcgaggtcacaaaccctccacctcgcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353669 |
aaaagagcatcaaatcttttttcctaataaatctgcacgggagttggtctctctgaaacaatgttgaatggtggcgaggtcacaaaccctccacctcgcc |
6353570 |
T |
 |
| Q |
120 |
acctcttcactacaaagatcttatggtaaatgctttgctaaacccgggtctgaattcttggaacattcctgtcatacaaaatctgtttgatgctactgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353569 |
acctcttcactacaaagatcttatggtaaatgctttgctaaacccgggtctgaattcttggaacattcctgtcatacaaaatctgtttgatgctactgat |
6353470 |
T |
 |
| Q |
220 |
gtaaccacaattctgtccattccactatttgctcgatcaagaactgattctcgaatctggaagtcaacggtgggtggagcttatactgtcaaaacagctt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353469 |
gtaaccacaattctgtccattccactatttgctcgatcaagaactgattctcgaatctggaagtcaacggtgggtggagcttatactgtcaaaacagctt |
6353370 |
T |
 |
| Q |
320 |
accgtctctgctcc |
333 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6353369 |
accgtctctgctcc |
6353356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 100 - 243
Target Start/End: Complemental strand, 23601262 - 23601120
Alignment:
| Q |
100 |
cacaaaccctccacctcgccacctcttcactacaaagatcttatggtaaatgctttgctaaacccgggtctgaattcttggaacattcctgtcatacaaa |
199 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||| ||||| |||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
23601262 |
cacaaaccctcaaccttgccacctcttcactataaatatcttacggtaa-tgctttgctaaacccgagtctgaattcttggaacatttctgtcatacaaa |
23601164 |
T |
 |
| Q |
200 |
atctgtttgatgctactgatgtaaccacaattctgtccattcca |
243 |
Q |
| |
|
|| |||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
23601163 |
atttgtttgatgctattgatgtaacagaaattctgtccattcca |
23601120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 333
Target Start/End: Complemental strand, 23601121 - 23601072
Alignment:
| Q |
284 |
caacggtgggtggagcttatactgtcaaaacagcttaccgtctctgctcc |
333 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
23601121 |
caacggtggatggagtttatactgtcaaaacaacttattgtctctgctcc |
23601072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University