View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8939_low_46 (Length: 241)
Name: NF8939_low_46
Description: NF8939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8939_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 33312825 - 33312628
Alignment:
| Q |
11 |
ttggtgttaaaaagtggaatgaaatgaaaaagactagttagattttatcttc---cattcaatttcactcaataccatcaatccaaacatatccaagact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33312825 |
ttggtgttaaaaagtggaatgaaatgaaaaagactagttagattttatcttcttccattcaatttcactcaataccatcaatccaaacatatccaagact |
33312726 |
T |
 |
| Q |
108 |
ttaaaccacatgtcttttattggcaatctgaaattgatctatcatagaat-aaacattgcagtaggaatgttaaaagaatgaatcttgacaagaaagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33312725 |
ttaaaccacatgtcttttattggcaatctgaaattgatctatcatagaatgaaacattgcagtaggaatgttaaaagaatgaatcttgaaaagaaagt |
33312628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University