View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8939_low_50 (Length: 202)
Name: NF8939_low_50
Description: NF8939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8939_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 37316761 - 37316937
Alignment:
| Q |
17 |
aaatcaaactatcataaatctcttgtcagtgagatgaaggttctcattgcctaattgagtaatgtttcttaacttttagaagc-----atacaacaaaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37316761 |
aaatcaaactatcataaatctcttgtcagtgagatgaaggttctcattgcctaattgagtaatgtttcttaacttttagaagcatacaatacaacaaaag |
37316860 |
T |
 |
| Q |
112 |
gtttgtactttgtacataaatcatctattgcagctgggaagtttttaccttgtgttattgcttcaatttgtaaacac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37316861 |
gtttgtactttgtacataaatcatctattgcagctgggaagtttttaccttgtgttattgcttcaatttgtaaacac |
37316937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University