View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8940_high_33 (Length: 206)

Name: NF8940_high_33
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8940_high_33
NF8940_high_33
[»] chr1 (1 HSPs)
chr1 (22-191)||(35364006-35364176)
[»] chr7 (2 HSPs)
chr7 (24-125)||(32662635-32662736)
chr7 (90-125)||(32656111-32656147)
[»] chr3 (1 HSPs)
chr3 (27-137)||(21786651-21786761)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 22 - 191
Target Start/End: Original strand, 35364006 - 35364176
Alignment:
22 acgatgaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnn-gaaatccctctaattgcttttatggattgaacattcacc 120  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||| ||||||||||||||    
35364006 acgatgaatgccgatctagatcatcaacgatcatgacaatcaccttccaatgattttttttgaaatccctctaattgcttttatgtattgaacattcacc 35364105  T
121 ttctgtcactgtcttcgctccctctgattcataatggaaggaaaaattataggaacacgttcaacaaacac 191  Q
    |||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
35364106 ttctgtcactgtcttcactccctctgattcataatgggaggaaaaactataggaacacgttcaacaaacac 35364176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 24 - 125
Target Start/End: Complemental strand, 32662736 - 32662635
Alignment:
24 gatgaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnngaaatccctctaattgcttttatggattgaacattcaccttc 123  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| | |||       ||||||  |||||||||||||| |||||||||||||||||||    
32662736 gatgaataccgatctagatcagcaacgatcatgacaatcaccttctagtgaatgttttgaaatctatctaattgcttttacggattgaacattcaccttc 32662637  T
124 tg 125  Q
    ||    
32662636 tg 32662635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 125
Target Start/End: Complemental strand, 32656147 - 32656111
Alignment:
90 tctaattgctttt-atggattgaacattcaccttctg 125  Q
    ||||||||||||| |||||||||||||||||||||||    
32656147 tctaattgctttttatggattgaacattcaccttctg 32656111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 27 - 137
Target Start/End: Complemental strand, 21786761 - 21786651
Alignment:
27 gaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnngaaatccctctaattgcttttatggattgaacattcaccttctgt 126  Q
    ||||||| |||||||||||||||||||||||||||||||||||  |||        |||||||||||||||||| ||| ||||||| | ||||| || |     
21786761 gaatacctatctagatcatcaacgatcatgacaatcaccttccggtgaatttttaaaaatccctctaattgcttgtatcgattgaataatcaccctccgc 21786662  T
127 cactgtcttcg 137  Q
    |||||||||||    
21786661 cactgtcttcg 21786651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University