View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8940_high_33 (Length: 206)
Name: NF8940_high_33
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8940_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 22 - 191
Target Start/End: Original strand, 35364006 - 35364176
Alignment:
| Q |
22 |
acgatgaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnn-gaaatccctctaattgcttttatggattgaacattcacc |
120 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35364006 |
acgatgaatgccgatctagatcatcaacgatcatgacaatcaccttccaatgattttttttgaaatccctctaattgcttttatgtattgaacattcacc |
35364105 |
T |
|
| Q |
121 |
ttctgtcactgtcttcgctccctctgattcataatggaaggaaaaattataggaacacgttcaacaaacac |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35364106 |
ttctgtcactgtcttcactccctctgattcataatgggaggaaaaactataggaacacgttcaacaaacac |
35364176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 24 - 125
Target Start/End: Complemental strand, 32662736 - 32662635
Alignment:
| Q |
24 |
gatgaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnngaaatccctctaattgcttttatggattgaacattcaccttc |
123 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| | ||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
32662736 |
gatgaataccgatctagatcagcaacgatcatgacaatcaccttctagtgaatgttttgaaatctatctaattgcttttacggattgaacattcaccttc |
32662637 |
T |
|
| Q |
124 |
tg |
125 |
Q |
| |
|
|| |
|
|
| T |
32662636 |
tg |
32662635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 125
Target Start/End: Complemental strand, 32656147 - 32656111
Alignment:
| Q |
90 |
tctaattgctttt-atggattgaacattcaccttctg |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32656147 |
tctaattgctttttatggattgaacattcaccttctg |
32656111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 27 - 137
Target Start/End: Complemental strand, 21786761 - 21786651
Alignment:
| Q |
27 |
gaataccgatctagatcatcaacgatcatgacaatcaccttccaatgannnnnnngaaatccctctaattgcttttatggattgaacattcaccttctgt |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||| ||||||| | ||||| || | |
|
|
| T |
21786761 |
gaatacctatctagatcatcaacgatcatgacaatcaccttccggtgaatttttaaaaatccctctaattgcttgtatcgattgaataatcaccctccgc |
21786662 |
T |
|
| Q |
127 |
cactgtcttcg |
137 |
Q |
| |
|
||||||||||| |
|
|
| T |
21786661 |
cactgtcttcg |
21786651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University