View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8940_low_10 (Length: 708)
Name: NF8940_low_10
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8940_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 40447613 - 40447325
Alignment:
| Q |
20 |
ggttgttgctacagctacggcggaaagtccttctaagaaaagaaaggttaatgacaaaggtggtgctattttaccggcgggatttctcagtcctcttgct |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447613 |
ggttgttgctaccgctacggcggaaagtccttctaagaaaagaaaggttaatgacaaaggtggtgctattttaccggcgggatttctcagtcctcttgct |
40447514 |
T |
|
| Q |
120 |
ccttctccttctccgtcgtcgacgccggtgaataatggtgttttgtctttgcctgcgcctgaatgggcttctacatcgaaccggttgaataaaagtgtta |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447513 |
ccttctccttctccggcgtcgacgccggtgaataatggtgttttgtctttgcctgcgcctgaatgggcttctacatcgaaccggttgaataaaagtgtta |
40447414 |
T |
|
| Q |
220 |
gctttagtcttaagggttgtaagcagttttggaaagccggtgattatggtggttctcctgctcgtgccttcgaatcttcaaccggtaac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447413 |
gctttagtcttaagggttgtaagcagttttggaaagccggtgattatggtggttctcctgctcgtgccttcgaatcttcaaccggtaac |
40447325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 420 - 624
Target Start/End: Complemental strand, 40447207 - 40447003
Alignment:
| Q |
420 |
gaatgaattttaccacattgcattttctttgggtaacaaaaactttagaaggttcagttttacaattgatttgatgactcagccaaacagatccatatca |
519 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447207 |
gaatgaattttaccacattgcattttctttaggtaacaataactttagaaggttcagttttacaattgatttgatgactcagccaaacagatccatatca |
40447108 |
T |
|
| Q |
520 |
tgcatgttagtgtttattcttggaagacttttgagaaaggaaattttgtatggatcttatgtggcattgtttcagaatgcaagttatcttcaattgttct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447107 |
tgcatgttagtgtttattcttggaagacttttgagaaaggaaattttgtatggatcttatatggcattgtttcagaatgcaagttatcttcaattgttct |
40447008 |
T |
|
| Q |
620 |
aaata |
624 |
Q |
| |
|
||||| |
|
|
| T |
40447007 |
aaata |
40447003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University