View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8940_low_61 (Length: 259)
Name: NF8940_low_61
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8940_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 20360819 - 20360593
Alignment:
| Q |
19 |
ggtctgcccctgggatattgagttcagcagagaatctttgcatgtgtcatatagtagtcatttcatgttgttcaaaagctgcccaaaagcttgattccct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20360819 |
ggtctgcccctgggatattgagttcagcagagaatctttgcatgtgtcatatagtagtcatttcatgttgttcaaaagctgcccaaaagcttgattccct |
20360720 |
T |
 |
| Q |
119 |
ctatattttcttcccgttctgtcacctagccttagctaggatttgactgggatttgcgaggggcatatccctcgttttttccctggcttttttcatgtct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20360719 |
ctatattttcttcccgttctgtcacctagccttagctaggatttgactaggatttgcgaggggcatatccctcgttttttccctggcttttttcatgtct |
20360620 |
T |
 |
| Q |
219 |
acataatccaatccgatccattttcat |
245 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
20360619 |
atataatccaatccgatccattttcat |
20360593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University