View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8940_low_67 (Length: 247)

Name: NF8940_low_67
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8940_low_67
NF8940_low_67
[»] chr1 (1 HSPs)
chr1 (1-228)||(9888290-9888517)
[»] chr2 (1 HSPs)
chr2 (61-189)||(31738260-31738388)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 9888290 - 9888517
Alignment:
1 aactcaccaattttccatcttttcaaaatgctcaaaaaattccaccattttttcaaaattcaccctttcgtagctattttactactatctctatctttag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
9888290 aactcaccaattttccatcttttcaaaatgctcaaaaaattccaccattttttcaaaattcaccctttcgtagctattttactactatctttatctttag 9888389  T
101 gtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatctgggttttgatgattatccgttttcgaagctcag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||    
9888390 gtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatctgggttttgatgattacccgttttcgaagctgag 9888489  T
201 gaatttggttatggttgctggtcattcg 228  Q
    ||||||||||||||||||||||||||||    
9888490 gaatttggttatggttgctggtcattcg 9888517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 189
Target Start/End: Original strand, 31738260 - 31738388
Alignment:
61 caccctttcgtagctattttactactatctctatctttaggtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaa 160  Q
    |||||| |||||||| | ||||||||| || |  ||||   ||| |||||||| ||||| |||||||||||  |||||||||| |||| |  | | ||||    
31738260 caccctctcgtagctctattactactagctttcactttcactatgaccctttttgttttgctctcttacaacacaacccaattaaacagtatcccaaaaa 31738359  T
161 ctgatctgggttttgatgattatccgttt 189  Q
    | ||||||||||||||  |||| ||||||    
31738360 cggatctgggttttgacaattacccgttt 31738388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University