View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8940_low_69 (Length: 247)
Name: NF8940_low_69
Description: NF8940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8940_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 9888290 - 9888517
Alignment:
| Q |
1 |
aactcaccaattttccatcttttcaaaatgctcaaaaaattccaccattttttcaaaattcaccctttcgtagctattttactactatctctatctttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9888290 |
aactcaccaattttccatcttttcaaaatgctcaaaaaattccaccattttttcaaaattcaccctttcgtagctattttactactatctttatctttag |
9888389 |
T |
 |
| Q |
101 |
gtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatctgggttttgatgattatccgttttcgaagctcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
9888390 |
gtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaactgatctgggttttgatgattacccgttttcgaagctgag |
9888489 |
T |
 |
| Q |
201 |
gaatttggttatggttgctggtcattcg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9888490 |
gaatttggttatggttgctggtcattcg |
9888517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 189
Target Start/End: Original strand, 31738260 - 31738388
Alignment:
| Q |
61 |
caccctttcgtagctattttactactatctctatctttaggtataacccttttcgtttttctctcttacaatgcaacccaattgaacaattacgcgaaaa |
160 |
Q |
| |
|
|||||| |||||||| | ||||||||| || | |||| ||| |||||||| ||||| ||||||||||| |||||||||| |||| | | | |||| |
|
|
| T |
31738260 |
caccctctcgtagctctattactactagctttcactttcactatgaccctttttgttttgctctcttacaacacaacccaattaaacagtatcccaaaaa |
31738359 |
T |
 |
| Q |
161 |
ctgatctgggttttgatgattatccgttt |
189 |
Q |
| |
|
| |||||||||||||| |||| |||||| |
|
|
| T |
31738360 |
cggatctgggttttgacaattacccgttt |
31738388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University