View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_high_15 (Length: 351)
Name: NF8941_high_15
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 237 - 343
Target Start/End: Original strand, 9716309 - 9716415
Alignment:
| Q |
237 |
tcgagagtaattaaaagcacaagatgcaagaatggaagatgcttagagttaaacgagggaatgaagaagatgatattagttaatcatgtttacccttgat |
336 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
9716309 |
tcgagagtaattaaaagcataagatacaagaatggaagatgcttagagttaaacgagagaatgaagaacatgatattagttaatcatgtttacccttaat |
9716408 |
T |
 |
| Q |
337 |
gtccatc |
343 |
Q |
| |
|
||||||| |
|
|
| T |
9716409 |
gtccatc |
9716415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 9716064 - 9716148
Alignment:
| Q |
1 |
ggcgggatatattgactaaaagaataatttaattaact-agtaatttatctcatgtaagtaccgtttttcacaatcactctcatt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9716064 |
ggcgggatatattgactaaaagaataatttaattaatttactaatttatctcatgtaagtaccgtttttcacaatcactctcatt |
9716148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University