View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_high_16 (Length: 340)
Name: NF8941_high_16
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_high_16 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0103 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 14674291 - 14674227
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctttatggcata |
65 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| |||||||||||||||||| || ||||| |
|
|
| T |
14674291 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtctgtatccgtgcttcatagcata |
14674227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 30183570 - 30183532
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgt |
40 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30183570 |
ttttcaaattattagttgtgtcggcatatcagtgtctgt |
30183532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 41995493 - 41995451
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||||||||||||| |
|
|
| T |
41995493 |
tttttcgaattattagttgtgtcggcgtgtcagtgtctgtgtc |
41995451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39698563 - 39698527
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtc |
37 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
39698563 |
tttttcaaattattagctgtgtcagcgtgtcagtgtc |
39698527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 18556494 - 18556554
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctttatggc |
62 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
18556494 |
ttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatccgtgctttatggc |
18556554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 46348420 - 46348475
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
46348420 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatccgtgctt |
46348475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 29144395 - 29144437
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
29144395 |
tttttcaaattattagctgtgtcggcgtatcagtgtcagtgtc |
29144437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37598854 - 37598800
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgt-ctgtgtctgtatccgtgc |
54 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| | |||||||| ||||||| |
|
|
| T |
37598854 |
tttttcaaattattagttgtgtcggcgtgtcagtgtccggtgtctgtgtccgtgc |
37598800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 42359486 - 42359527
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgt |
42 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
42359486 |
tttttcaaattattagatgtgtcagcgtgtcagtgtccgtgt |
42359527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 22881653 - 22881689
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtc |
37 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
22881653 |
tttttcaaattattagttgtgtcggcgtgtcagtgtc |
22881689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 24577223 - 24577259
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |
|
|
| T |
24577223 |
tttttcaaattattagttgtgtcagcgtgtccgtgtc |
24577259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 36450791 - 36450846
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
36450791 |
tttttcaaattattagttgtgtcggcgtgtcagtgtccgtgtccgtatccgtgctt |
36450846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15816166 - 15816202
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtc |
37 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
15816166 |
tttttcaaattattagttgtgtcggcgtgtcagtgtc |
15816202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 34306840 - 34306879
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgt |
40 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34306840 |
tttttcaaattattagttgtgtcggcgtatcagtgtctgt |
34306879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 2 - 43
Target Start/End: Complemental strand, 19482689 - 19482648
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19482689 |
ttttcaaattattagttgtgtcggcgtgtcagtgtctgtgtc |
19482648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 324
Target Start/End: Original strand, 10419821 - 10419889
Alignment:
| Q |
256 |
gttgtacaaataaaggacactgtctaaattttgctagagatattttagcgtagcattttgaactatttt |
324 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||| |||| ||| |||| | ||||||||||||||||||| |
|
|
| T |
10419821 |
gttgtataaacaaaggacactgtaaaaattttgatagaaatagtttaacttagcattttgaactatttt |
10419889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 30298968 - 30298913
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| ||||| |||||| |
|
|
| T |
30298968 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatctgtgctt |
30298913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 30327836 - 30327781
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| ||||| |||||| |
|
|
| T |
30327836 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatctgtgctt |
30327781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 24544003 - 24543947
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtct-gtgtctgtatccgtgctt |
56 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||| ||||| |||||| ||||| |
|
|
| T |
24544003 |
ttttttaaattattagttgtgtcggcgtgtcagtgtctggtgtccgtatccatgctt |
24543947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 54580060 - 54580117
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgt-ctgtgtctgtatccgtgctttat |
59 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| | ||||||||||||||| ||||| |
|
|
| T |
54580060 |
tttttcaaattattagttgtgtcagcg--tccgtgtccggtgtctgtatccgtgttttat |
54580117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 16833330 - 16833288
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
16833330 |
tttttcaaattattagttgtgtcggcgtgtcagtgtctgtgtc |
16833288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 17302578 - 17302530
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
17302578 |
tttttcaaattattagttgtgtcagcgtgtcagtgttcgtgtccgtatc |
17302530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 17841626 - 17841681
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| ||||| |||||| |
|
|
| T |
17841626 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatcagtgctt |
17841681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 8777010 - 8777052
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
8777010 |
tttttcaaattattagttgtgtcggcgtgtcagtgtccgtgtc |
8777052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 43
Target Start/End: Original strand, 8365557 - 8365598
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
8365557 |
ttttcaaattattagttgtgtcggcgtgtcagtgtccgtgtc |
8365598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 55401097 - 55401055
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
55401097 |
tttttcaaattattagttgtgtcggcgtatcagtgtccgtgtc |
55401055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 2 - 43
Target Start/End: Complemental strand, 33359782 - 33359741
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33359782 |
ttttcaaattattagctgtgtcagcgtgtcagtgtctgtgtc |
33359741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 20503487 - 20503433
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||| |||||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
20503487 |
tttttcaaattatttgttgtgtcggcgtgtcagtgtc-gtgtccgtatccgtgctt |
20503433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 40052354 - 40052300
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
40052354 |
tttttcaaattattagctgtgtcggcgtgtcagtgtc-gtgtccgtatccgtgctt |
40052300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 10335323 - 10335365
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
10335323 |
tttttcaaattattagttgtgtcggcgtgtcagtgtccgtgtc |
10335365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 14829712 - 14829670
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
14829712 |
tttttcaaattattagctgtgtcggcgtgtcagtgtctgtgtc |
14829670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 16000053 - 16000095
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
16000053 |
ttttttaaattattagttgtgtcggcgtgtcagtgtctgtgtc |
16000095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 43
Target Start/End: Original strand, 41961688 - 41961729
Alignment:
| Q |
2 |
ttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
41961688 |
ttttcaaattattagttgtgacggcgtgtcagtgtctgtgtc |
41961729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 3865593 - 3865637
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctg |
45 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||||| |
|
|
| T |
3865593 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtctg |
3865637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 34910339 - 34910284
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtct-gtgtctgtatccgtgctt |
56 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||| ||||| |||||||||||| |
|
|
| T |
34910339 |
tttttcaaattattagttgtgtcggcgtgtc-gtgtctggtgtccgtatccgtgctt |
34910284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 18841050 - 18841086
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18841050 |
tttttcaaattattagttgtgtcagcgtgtcagtgtc |
18841086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 37558999 - 37558944
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatccgtgctt |
56 |
Q |
| |
|
|||| ||||||||||| |||||| |||| |||||||| ||||| |||||||||||| |
|
|
| T |
37558999 |
ttttacaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatccgtgctt |
37558944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 12940972 - 12941014
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
12940972 |
tttttcaaattattagttgtgtcaacgtgtcagtgtccgtgtc |
12941014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 178856 - 178898
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtc |
43 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
178856 |
tttttcaaattattagttgtgtcggcgtgtcagtgtccgtgtc |
178898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 51833 - 51784
Alignment:
| Q |
1 |
tttttcaaattattagttgtgtcagcgtatcagtgtctgtgtctgtatcc |
50 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||| ||||| |||||| |
|
|
| T |
51833 |
tttttcaaattattagctgtgtcggcgtgtcagtgtccgtgtccgtatcc |
51784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University