View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_high_27 (Length: 234)
Name: NF8941_high_27
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 51394527 - 51394361
Alignment:
| Q |
64 |
ttgagatatttcaaaaggacaattactcttttgcaataccagcttgaagagaaatgctagcaatagagtaatctctgacctacatttttcctcacaaact |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51394527 |
ttgagatatttcaaaaggacaattactcttttgcaataccagcttgaagagaaatgctagcaatagagtaatctctgacatacatttttcctcacaaact |
51394428 |
T |
 |
| Q |
164 |
atattattaaatgaaattcaaaatagttctgtttgaacttaacaagtgtggtggtgcatggtaggaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51394427 |
atattattaaatgaaattcaaaatagttctgtttgaacttaacaagtgtggtggtgcatggtaggaa |
51394361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 51394590 - 51394562
Alignment:
| Q |
1 |
atggaaaagagtaaatcccatactataag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51394590 |
atggaaaagagtaaatcccatactataag |
51394562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University