View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_low_12 (Length: 595)
Name: NF8941_low_12
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_low_12 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 170; Significance: 6e-91; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 15 - 235
Target Start/End: Complemental strand, 42677 - 42459
Alignment:
| Q |
15 |
tacttatattttttgtacattaagatatcaaattttaccctttagcaatgtattacataactaattgcaaccataaataatgttttaatgcagattttta |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
42677 |
tacttatattttttgtacatcaagatatccaatttcaccaattagcaatgtattacataactaattgcaaccataaataatgtattaatgcagatttcaa |
42578 |
T |
 |
| Q |
115 |
gagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaagggctttgcagaacgttatgaaggtgttgcacactcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
42577 |
gagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaaggactttgc--aacgttatgaaggtgttgcacactcc |
42480 |
T |
 |
| Q |
215 |
tctctccggtttatcagattt |
235 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
42479 |
tctctccggtttatcggattt |
42459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 333 - 442
Target Start/End: Complemental strand, 41232 - 41127
Alignment:
| Q |
333 |
acttgattgtatacatttaaccagtaaatatttcatgaaaccttcatcttattatagtacgccgtgattgtactcatcgaacagtggccggtaactcgag |
432 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| | || ||||||| ||| |
|
|
| T |
41232 |
acttgattgtatacatttaactagtaaatatttcatgaaaccttcatcttattataatacgccgtgattgtattcatcgatcggt----ggtaacttgag |
41137 |
T |
 |
| Q |
433 |
gaattatttt |
442 |
Q |
| |
|
|||||||||| |
|
|
| T |
41136 |
gaattatttt |
41127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University