View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8941_low_62 (Length: 225)
Name: NF8941_low_62
Description: NF8941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8941_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 37697140 - 37696939
Alignment:
| Q |
8 |
ggaggagcagagatggagtcccaaaggaaatcctggttttgatcgtaattagagcaatcaaggctagtattatatccacttttacaaacacaaacaaatc |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37697140 |
ggaggaggagagatggagtcccaaaggaaatcctggttttgatcgtaattagagcaatcaaggctagtattatatccacttttacaaacacaaacaaatc |
37697041 |
T |
 |
| Q |
108 |
cacttcctggaggagcatatccacacacaccaccactactctcacaactagtacactcagtggtcacaatgtcatcaaaaacaccatgtgtatatttcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37697040 |
cacttcctggaggagcatatccacacacaccaccactactctcacaactagtacacttagtggtcacaatgtcatcaaaaacaccatgtgtatatttcaa |
37696941 |
T |
 |
| Q |
208 |
tg |
209 |
Q |
| |
|
|| |
|
|
| T |
37696940 |
tg |
37696939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University